Metal-responsive transcription factor-1 (MTF-1) selects different types of metal response elements at low vs. high zinc concentration.
Journal article

Metal-responsive transcription factor-1 (MTF-1) selects different types of metal response elements at low vs. high zinc concentration.

  • 2004-08-21
Published in:
  • Biological chemistry. - 2004
English Metal-responsive transcription factor-1 (MTF-1) is a zinc finger protein with a central role in heavy metal homeostasis/detoxification. MTF-1 binds to DNA sequence motifs known as metal response elements (MREs) with a core consensus TGCRCNC. Since MTF-1 is also involved in other stress responses, we tested whether it is able to recognize different types of DNA sequence motifs. To this end we selected MTF-1-binding oligonucleotides from a collection of random sequences. Since MTF-1 binds to known target sequences at relatively high zinc concentrations, oligonucleotide selection was performed in a mammalian cell nuclear extract both at high and low zinc concentrations. Irrespective of zinc concentration, we find a robust representation of MRE consensus sequences, however with specific features. Selection was most efficient at 100 microM zinc, yielding many oligonucleotides with two MRE motifs in divergent orientation of the sequence GTGTGCATCACTTTGCGCAC (core consensus underlined). Oligonucleotides selected without zinc supplement contain a single high-affinity MRE with an extended flanking sequence of consensus TTTTGCGCACGGCACTAAAT (core consensus underlined). This low-zinc MRE motif can bind MTF-1 and induce transcription in vivo, and is less dependent on zinc than the classical MREd motif from the mouse metallothionein-I promoter. At low zinc, we also found evidence for a negative role of nuclear factor-I (NF-I/CTF-I) in MTF-1-dependent transcription. Finally, a selection in the presence of cadmium yielded no specific binding site for MTF-1, strongly supporting the concept of an indirect activation of MTF-1 by cadmium within a living cell.
Language
  • English
Open access status
closed
Identifiers
Persistent URL
https://sonar.ch/global/documents/163439
Statistics

Document views: 32 File downloads: